Fecha de publicación: noviembre 13, 2020| Publicado en el Número 5

Uso de CRISPR/Cas9 como herramienta de edición de genomas en hongos filamentosos: una revisión del estado actual y últimas tendencias

 Andrés Astudillo-Echeverría1,2*, David Pazmiño-Centeno1,2*, Leopoldo Naranjo-Briceño1,2,3

 

1 Facultad de Ciencias de la Vida, Ingeniería en Biotecnología. Universidad Regional Amazónica Ikiam, vía Muyuna, km. 7, CP 150150, Tena, Ecuador.
2 Grupo de Microbiología Aplicada, Universidad Regional Amazónica Ikiam, vía Muyuna, km. 7, CP 150150, Tena, Ecuador.
3 Spora Biotech, Fundo Santa Paulina, Rosario, Rengo, VI Región del General Libertador Bernardo O’Higgins, CP 2940000, Chile.
* Igual contribución de los autores
Autor de Correspondencia: Leopoldo Naranjo-Briceño. Mail: leopoldo.naranjo@ikiam.edu.ec / lenaranjo@mail.com

Resumen

Los hongos filamentosos son organismos eucariotas cosmopolitas que poseen numerosas aplicaciones biotecnológicas, se utilizan como factorías celulares para la producción de compuestos bioactivos, pigmentos, proteínas y enzimas y además, son empleados como biocatalizadores en procesos de micorremediación, en la obtención de nuevas fuentes de bioenergía y en el desarrollo de neo-biomateriales como en las áreas de la micotectura y de biotextiles sustentables.

Debido a su enorme impacto industrial y ambiental, existe la necesidad de estudiar las funciones de los genes, proteínas y las rutas metabólicas asociadas con la síntesis de biomoléculas en estos microorganismos. Por estos motivos, surge el enorme interés de aplicar la técnica de edición de genomas CRISPR/Cas9 (por sus siglas en inglés, Clustered Regularly Interspaced Short Palindromic Repeats / (CRISPR)-associated-nuclease 9) en hongos filamentosos. En comparación con las herramientas de edición genómicas anteriores, CRISPR/Cas9 es una herramienta de ingeniería genómica de bajo costo que ofrece una alta versatilidad, especificidad y eficiencia. Esta herramienta puede generar cambios en el genoma de cualquier organismo de forma rápida y precisa sin incorporar ADN de especies foráneas en el huésped.

Esta revisión describe el estado actual de esta herramienta en la edición de genomas de hongos filamentosos, incluyendo variantes del sistema CRISPR y estrategias para establecerlo en células fúngicas, realizando especial énfasis en la frecuencia de uso de marcadores positivos para la selección de transformantes o cotransformantes, y de promotores para la expresión heteróloga del gen CAS9 y del sgRNA (por sus siglas en inglés, single guide RNA). Se llevó a cabo una revisión exhaustiva desde el inicio de la implementación de CRISPR/Cas9 en hongos filamentosos hasta la fecha (período comprendido entre 2015-2020), abarcando un total de 137 artículos científicos.

 

Filamentous fungi are cosmopolitan eukaryotic organisms that host several biotechnological applications. They are used as biofactories for bioactive compounds, proteins, pigments, and enzymes production. They have been used as biocatalyst in mycoremediation process, getting new bioenergy sources, and in neo-biomaterials development, such those in mycotecture and sustainable biotextiles approaches.

There is an increasing interest in studying metabolic pathways, proteins, and related genes functions to biomolecules synthesis of these organisms due to its both huge environmental and industrial impact. For these reasons, the application of genome editing technique CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-associated-nuclease 9) has started in filamentous fungi. Related to older genome editing tools, CRISPR/Cas9 is a cost-effective genome engineering tool offering specificity, versatility and efficiency. This tool can make changes into the genome of any organism in a fast and precise way without taking DNA into the host from foreign species.

This review describes the current state of this genome editing tool in filamentous fungi, considering CRISPR systems variants and strategies to establish CRISPR/Cas9 in fungi cells, and by making unique insight in the frequency of usage of positive markers for selection of transformants or co-transformants, and promoters for the heterologous expressions of CAS9 gene and sgRNA (single guide RNA). A comprehensive review was carried out from the beginning of CRISPR/Cas9 implementation in filamentous fungi to the current date (the period from 2015 – 2020), covering a total of 137 scientific articles.

 

INTRODUCCIÓN

Los hongos filamentosos son organismos eucariotas cosmopolitas, ya que poseen una amplia distribución en el medio ambiente. Desde tiempos ancestrales, en la cultura oriental, los hongos filamentosos se han empleado como materia prima para la elaboración de productos alimenticios fermentados de sabor y de valor nutritivo agregados (Van der Strat et al., 2014; Michelson et al., 2010; Schuster et al., 2002; Nødvig et al., 2015; Egbuta et al., 2016). Actualmente, los hongos filamentosos se utilizan ampliamente como fuentes de compuestos bioactivos, pigmentos, proteínas y enzimas en diversos sectores industriales alimentarios y no-alimentarios, para la obtención de nuevas fuentes de bioenergía (bioetanol), desarrollo de nuevos biomateriales a partir de su micelio (Mycelium Technology), como medios de control biológico de plagas y enfermedades en la agricultura sostenible, así como también en procesos de micorremediación de suelos contaminados con hidrocarburos recalcitrantes, entre otros compuestos orgánicos tóxicos y contaminantes (Naranjo-Briceño et al., 2019). Aspergillus niger, Aspergillus oryzae, Trichoderma reesei y Penicillium spp., son los géneros de hongos filamentosos que más se emplean en la industria (Tabla 1). Además de poseer una poderosa maquinaria enzimática altamente activa y de fácil transporte al medio extracelular, estos microorganismos son considerados como GRAS (por sus siglas en inglés, Generally Recognized as Safe) por la FDA (por sus siglas en inglés, Food and Drug Administration, USA), por lo que su uso es seguro para la producción de metabolitos y enzimas destinados para el uso alimenticio humano. Por los motivos antes mencionados, ha existido la necesidad de contar con las herramientas técnicas apropiadas para estudiar y aprovechar las capacidades metabólicas de los hongos filamentosos y descubrir nuevas moléculas con interesantes aplicaciones biotecnológicas (Deng et al., 2017a).

Se han descrito diversas herramientas moleculares para manipular el genoma de los hongos filamentosos, entre las que se incluyen la recombinación homóloga, etiquetado de transposones y la integración mediada por agrobacterias. Sin embargo, los métodos mencionados presentan ciertas limitaciones, asociadas con la recombinación homóloga ineficiente y la reducida cantidad de marcadores de selección que requieren pasos adicionales para el reciclaje de los mismos. Con respecto al marcaje de transposones, no se puede controlar la manipulación dirigida y se obtiene una gran cantidad de transformantes, mientras que en la integración mediada por agrobacterias influyen varios factores en la eficiencia de este método, principalmente, el tipo de material fúngico inicial (protoplastos, esporas o hifas) (Wang et al., 2017; Schuster et al., 2019; Li et al., 2017). Además, se pueden generar complicaciones para determinar la función de genes en hongos filamentosos diploides y multinucleados porque se requiere la mutación de todos los alelos para determinar cómo afecta el gen de interés en el desarrollo de un determinado fenotipo (Wang y Coleman et al., 2019).

Entre las tecnologías de edición de genomas también se incluyen las proteínas diseñadas para modificar loci específicos, como las nucleasas dedos de zinc (ZFNs) (por sus siglas en inglés, zinc-finger nucleases) y las nucleasas efectoras de transcripción similares a activadores (TALENs) (por sus siglas en inglés, transcription activator-like effector nucleases), siendo éstas últimas implementadas en la edición genómica de hongos filamentosos (Liu et al., 2017; Wang et al., 2017). No obstante, estas tecnologías presentan dificultades en los procesos de diseño, síntesis y validación de las proteínas que reconocen los loci específicos de interés (Doudna y Charpentier, 2014), y requieren una cantidad considerable de tiempo para su implementación (Song et al., 2019; Deng et al., 2017a), por lo que éstas tecnologías no han sido ampliamente aplicadas en la edición de genomas de hongos. Además, ZFN y TALEN no tienen la capacidad para editar múltiples genes a la vez (Song et al., 2019).

Todas estas dificultades para la edición de genomas han sido superadas con el surgimiento y reciente aplicación del sistema de edición de genomas CRISPR/Cas9. En comparación con ZFN y TALEN, CRISPR/Cas9 posee la capacidad de editar múltiples genes a la vez, mejorando la eficiencia en la edición de genomas, porque a partir de una sola transformación se pueden generar mutantes que poseen múltiples loci editados. Además, CRISPR/Cas9 es un sistema que está conformado por componentes simples, permitiendo que su aplicación sea rápida y versátil (Doudna y Charpentier, 2014; Deng et al., 2017a). Por el desarrollo de la técnica CRISPR/Cas9 como un método para la edición del genoma, las investigadoras Emmanuelle Charpentier y Jennifer A. Doudna, han recibido el Premio Nobel de Química de 2020.

Desde que la técnica CRISPR/Cas9 llegó a la comunidad científica, se han expuesto diferentes estrategias para la edición de genes en hongos filamentosos (Nødvig et al., 2015). Las estrategias difieren en el uso de promotores tanto para la expresión heteróloga del gen CAS9 como del sgRNA, así como también difieren en el uso de marcadores de selección de transformantes positivos. El objetivo del presente artículo de revisión es precisamente describir las últimas tendencias hasta la fecha en el uso de promotores (constitutivos e inducibles) para la expresión heteróloga de la proteína Cas9 y del sgRNA, y en los marcadores de selección de transformantes o cotransformantes.

 

Tabla 1. Principales hongos filamentosos empleados como biofactorías en la industria (continúa en siguiente página).

Hongo filamentoso Tipo de Biomolécula   Aplicación   Referencias
Salud Agricultura /              Ambiente Industria
Aspergillus flavus Uricasa, lipasa, proteasa Gota Biorremediación, biocontrol Detergentes, elaboración de cueros Singh et al., 2016; Kurniati et al., 2014; Abbas et al., 2011
A. niger Glucoamilasa, ácido              cítrico, ácido glucónico, pythase NA Biorremediación Cosméticos,                 adhesivos Shah et al., 2017; Tang et al., 2015; Majumder et al., 2010; Schuster et al., 2002
A. oryzae Ácido kpojico, α-amilasa, proteasa, lipasa, Desórdenes digestivos, antioxidantes NA Cosméticos, alimentos, detergentes Singh et al., 2016; Ogawa et al., 1995; Francis et al., 2003
A. terreus Ácido itacónico,                      lovostatina, Antibióticos NA Polímeros sintéticos, biocombustible Van der Strat et al., 2014; Jahromi et al., 2012; Dwiarti et al., 2007; Pushalkar y Rao, 1998
Blakeslea trispora Caroteno, licopeno NA Alimentación, Textil NA Mantzouridou y Naziri, 2017; Nanou y Roukas, 2016
Botrytis cinerea Ácido abcísico NA NA NA Marumo et al., 1982
Cunninghamella echinulata γ-Ácido linoleico NA NA NA Fakas et al., 2008
Fusarium fujikuroi Giberelina NA NA NA Shi et al., 2017
F. oxysporum Bioetanol, clicosporina Antibióticos Biocontrol Biocombustible Sharmila et al.,

2012; Kaur et al.,

2010; Panagiotou et al., 2004

F. verticillioides Bioetanol NA NA Biocombustible de Almeida et al., 2013
Myceliophthora thermophila Celulasa NA NA Biocombustible Liu et al., 2017
Monascus spp. Pigmentos naturales:  monascina, ankaflavina, rubropunctatina,                       monascorubrina Anticancerígeno Alimentación Textil Xiong et al., 2014; Chen et al., 2017a
Mortierella alpina Ácido araquidónico Ji et al., 2014
M. isabellina γ-Ácido linoleico Mo et al., 2002
M. ramanniana γ-Ácido linoleico Dyal et al., 2005
Mucor circinelloides γ-Ácido linoleico Zhang et al., 2017
Neurospora crassa Bioetanol Biocombustible Davis y Perkins, 2002; Colvin et al., 1973

 

PRINCIPIOS Y COMPONENTES DEL SISTEMA CRISPR/Cas9

 

El sistema CRISPR/Cas tiene su origen en los loci CRISPR-Cas de bacterias y arqueas, en las que funciona como un sistema de inmunidad adaptativa mediante el cual estos microorganismos se defienden natural y espontáneamente de los virus. Cada locus está estructurado principalmente por secuencias cortas repetitivas de ADN, intercaladas por espaciadores, y por un operon de genes cas codificantes de componentes proteicos Cas (Doudna y Charpentier, 2014). Las secuencias espaciadoras incorporadas en los loci provienen de material genético de virus que han causado infecciones anteriores. El ARN precursor asociado a CRISPR (pre-crRNA) es formado a partir de la transcripción de las secuencias repetitivas en conjunto con los espaciadores, que posteriormente al proceso de maduración, forman ARNs asociados a CRISPR (crRNAs) listos para generar una escisión específica al ADN invasor gracias a la actividad catalítica de proteínas Cas. Esto ocurre en sitios específicos de complementariedad del crRNA con el ADN invasor.

Estudios recientes sugieren dos clases y seis tipos de sistema CRISPR/Cas. El sistema de clase 1 incluye los tipos I, III y IV, mientras que el sistema de clase 2 incluye los tipos II, V y VI. De estos sistemas, los de clase 2 tipo II tienen un uso más extendido en la comunidad científica, debido a la simplicidad de su mecanismo (Makarova et al., 2015; Shmakov et al., 2017).

 

 

Figura 1. Sistema CRISPR/Cas9. A) La nucleasa Cas9 (amarillo) es guiada a la secuencia diana por el sgRNA (verde). La secuencia protoespaciadora (verde claro) se une a la cadena complementaria de la secuencia diana corriente arriba de PAM. De esta manera Cas9 realiza la rotura de doble cadena. Las tijeras indican el sitio de escisión, 3-5 pares de bases corriente arriba de PAM. B) Genes codificantes de Cas9 y sgRNA en un vector de replicación autónoma AMA1. Tras el DBS inducido por el sistema CRISPR/Cas9 y en ausencia de una plantilla homóloga (lateral izquierdo), la reparación del ADN es mediada por NHEJ que es propensa a errores, generando mutaciones en el proceso. La reparación vía HDR ocurre en presencia de un sustrato de direccionamiento genético lineal o circular (lateral derecho), dando como resultado la inserción de un gen marcador (naranja). Adaptado de Nødvig et al. (2015).

 

El sistema de CRISPR/Cas de tipo II está compuesto por la proteína Cas9 (nucleasa), el crRNA maduro, el trans-activador de crRNA (tracrRNA) y la RNasa III. Este sistema fue optimizado para constituir un sistema de dos componentes principales (Jinek et al., 2012), tal como muestra la Figura 1A: una endonucleasa Cas9 y un RNA guía (sgRNA, por sus siglas en inglés, single guide RNA) formado por la fusión del crRNA maduro con el tracrRNA. La proteína Cas9, aislada originalmente de la bacteria Streptococcus pyogenes, presenta actividad endonucleasa debido a sus dos distintos dominios catalíticos, un dominio de nucleasa HNH, que permite escindir la cadena de ADN complementaria a la secuencia del ARN guía, y un dominio de nucleasa tipo RuvC, responsable de escindir el ADN de cadena opuesta a la complementaria (Chen et al., 2014). El sgRNA está conformado por una secuencia de andamiaje (scaffold) en el extremo 3’ y un espaciador de alrededor de 20 nucleótidos en el extremo 5’ que define el objetivo en la secuencia de ADN (Jinek et al., 2012).

El complejo de ribonucleoproteína (RNP) CRISPR/Cas9 se forma cuando ambos componentes se unen a través de las interacciones de la secuencia de andamiaje del sgRNA con la superficie cargada positivamente de la proteína Cas9. Esta unión provoca un cambio conformacional en Cas9 que la activa y permite la unión del sgRNA a la secuencia objetivo de ADN complementario (Jinek et al., 2014). Corriente arriba de la secuencia objetivo, se ubica el motivo adyacente al protoespaciador PAM (por sus siglas en inglés, Protospacer Adjacent Motif). La unión de la proteína Cas9 en la secuencia objetivo ocurre a través de una señal de unión que es mediada por PAM, la cual es una secuencia altamente conservada que presenta una longitud de alrededor de 3 a 5 nucleótidos. Esta secuencia es NGG para la Cas9 de S. pyogenes (Gasiunas et al., 2012). Una vez reconocido este motivo adyacente, la proteína Cas9 sufre un segundo cambio conformacional permitiendo unir los dominios de la endonucleasa al ADN objetivo y escindirlo. El producto de la escisión del complejo CRISPR/Cas9 es una ruptura de la doble cadena del ADN objetivo (DSB, por sus siglas en inglés Double-Strand Break) (Nishimatsu et al., 2014) que activa dos mecanismos de reparación de ADN de doble cadena (dsDNA).

La Figura 1B muestra los mecanismos de reparación del dsDNA, los cuales se realizan mediante la unión de extremos no homólogos (NHEJ, por sus siglas en inglés, Non-homologous End Joining) o mediante la vía de reparación dirigida por homología de alta fidelidad (HDR, por sus siglas en inglés, Homology-Directed Repair) (Sander y Joung 2014). El mecanismo de reparación NHEJ inserta y deleciona nucleótidos (INDELs) aleatoriamente hasta conseguir rellenar y aparear nuevamente los dos extremos de las cadenas y, finalmente, restaurar/ligar el dsDNA escindido por Cas9. Al haber insertado/delecionado nucleótidos de manera aleatoria, la secuencia del gen se habrá alterado, provocando la inactivación del gen (vía mutación NHEJ). En contraste, el sistema de reparación HDR es más eficiente, pudiendo editar el DSB empleando secuencias molde de dsDNA externas que presentan en sus extremos 5’ y 3’ fragmentos homólogos que flanquean a la secuencia de ADN de interés u objeto de estudio. Es decir, este sistema facilita la introducción de secuencias de dsDNA previamente inexistentes en el genoma, lo cual permite tanto incorporar mutaciones específicas como corregirlas (vía edición-substitución), así como introducir fragmentos de ADN homólogos o heterólogos de gran tamaño que portan información de interés. El mecanismo de reparación NHEJ puede ocurrir en células que se encuentran o no en división celular, mientras que el mecanismo HDR sólo ocurre en células en división celular, lo cual constituye una limitación en este mecanismo de reparación de ADN (Wang y Coleman, 2019).

La edición de genomas en hongos filamentosos mediado por endonucleasas Cas9 tipo II es de uso extendido. Sin embargo, estudios recientes han incorporado el uso de endonucleasas tipo V Cpf1 en hongos filamentosos, las cuales han sido acopladas en la edición de genomas de manera exitosa (Jiménez et al., 2020; Vanegas et al., 2019). A diferencia de las endonucleasas Cas9, las Cpf1 reconocen regiones PAMs ricas en timina (Zetsche et al., 2015; Kim et al.,  2017) y poseen arreglos de crRNAs que no dependen de tracrRNAs (Zetsche et al., 2015) para la rotura de ADN de las secuencias objetivo. Estas características permiten simplificar el diseño de los sistemas CRISPR y ampliar, en teoría, los sitios de modificación no disponibles para Cas9. Las ventajas de estas endonucleasas tipo V Cpf1 aún deben seguir siendo estudiadas en la edición de genomas en hongos filamentosos (Fu et al., 2019).

Los sistemas CRISPR/Cas9, a pesar de su alta eficiencia, pueden presentar dificultades por la inespecificidad del sistema para sitios que comparten secuencias homólogas con la secuencia objetivo, produciendo modificaciones en genes diferentes al de interés, denominadas off-targets (Zhang et al., 2015). Para reducir la posibilidad de generar off-targets, han surgido modificaciones en el sistema CRISPR en las cuales se generan mutantes de Cas9 denominadas nickasas Cas9 (Cas9n), que tienen uno de los dos dominios catalíticos inactivos. Cas9n genera una rotura simple de ADN con el objetivo de inducir principalmente el mecanismo de reparación HDR, reduciendo de esta manera mutaciones off-targets (Cong et al., 2013).  El sistema editor de base dependiente de CRISPR/Cas9 fue aplicado exitosamente en el hongo A. Niger, fusionando la función citidina desaminasa con una Cas9 nickasa para inactivar el gen auxótrofo de uridina pyrG y el gen de pigmento fwnA (Huang et al., 2019). Por otro lado, versiones modificadas de Cas9 han sido creadas para mejorar la especificidad en la edición genómica, tales como eSpCas9 (Slaymaker et al., 2016) diseñada para tener interacciones débiles entre Cas9 y sitios off-targets, y Cas9-HF1 (Kleinstiver et al., 2016), que evita el contacto no específico con regiones off-targets. La versión eSpCas9 ha sido utilizada de manera exitosa en el hongo Sporisorium scitamineum para el silenciamiento del gen Mfa2 (Lu et al., 2017) mientras que Cas9-HF1 aún no ha sido implementada en hongos filamentosos.

En relación al sistema CRISPR/Cas9, el diseño in silico del sgRNA es un paso determinante para disminuir el riesgo por off-targets. Actualmente, varias plataformas bioinformáticas cuentan con diferentes algoritmos destinados a diseñar sgRNA con el menor número de off-targets posible, sin embargo, no todos incluyen genomas de hongos filamentosos en sus bases de datos. La comprensión del mecanismo de acción del sistema CRISPR/Cas9, y el creciente aumento de genomas secuenciados gracias al desarrollo de nuevas tecnologías de secuenciación como la secuenciación masiva (NGS por sus siglas en inglés, Next Generation Sequencing), han hecho posible mejorar el diseño de los sgRNA. La Tabla 2 resume los principales programas bioinformáticos para el diseño de sgRNA que cuentan con genomas de hongos filamentosos en sus bases de datos.

 

Tabla 2. Principales programas bioinformáticos empleados en el diseño de sgRNAs para la edición de genomas de hongos filamentosos.

Nombre Sitio Web Genomas disponibles Lista de genomas (enlace) Referencia
N° de                    especies Hongos       filamentosos
CRISPR                       direct http://crispr.dbcls.jp/ >200 Si https://gist.github.com/meso-cacase/88157c741a17c0920c7c57dcd2b39a3d

 

https://gist.github.com/meso-cacase/ef314e1e2ac4399fe20cd50fec77ce24

Naito et al., 2015
EuPaGDT http://grna.ctegd.uga.edu/ >250 Si En el mismo sitio web Peng y Tarleton, 2015
Benchling https://www.benchling.com/crispr/ >1000 Si http://fungi.ensembl.org/index.html Benchling, Inc.
Breakig-Cas http://bioinfogp.cnb.csic.es/tools/breakingcas >1000 Si En el mismo sitio Web Oliveros et al., 2016
Cas-Designer http://www.rgenome.net/cas-designer/ >200 Si En el mismo sitio Web Park et al., 2015
E-CRISPR http://www.e-crisp.org/E-CRISP/ 55 Si En el mismo sitio Web Heigwer et al., 2014
CCtop https://cctop.cos.uni-heidelberg.de 50 Si En el mismo sitio Web Stemmer et al., 2015
CRISPOR http://crispor.tefor.net 430 Si En el mismo sitio Web Haeussler et al., 2016
CHOPCHOP http://chopchop.cbu.uib.no 91 Si En el mismo sitio Web Montague et al., 2014

 

CRISPR/Cas9 EN LA EDICIÓN DE GENOMAS DE HONGOS FILAMENTOSOS: ÚLTIMAS TENDENCIAS

La herramienta CRISPR/Cas para la edición de genomas ha revolucionado los laboratorios de todo el mundo, siendo el sistema tipo II de CRISPR/spCas9 de S. pyogenes el que ha demostrado el mayor rendimiento en genómica funcional en hongos filamentosos (Jinek et al., 2012; Komor et al., 2017), mostrando una alta precisión y simplicidad. Para el diseño y desarrollo de una nueva estrategia de edición de genomas de hongos filamentosos basados en el sistema CRISPR/Cas9, es necesario considerar cuatro aspectos medulares: a) estrategias para establecer el sistema CRISPR/Cas9 en células fúngicas, b) marcadores de selección positiva de transformantes (casetes de selección), c) mecanismos de expresión del gen CAS9 y, d) mecanismos de expresión de sgRNA.

 

Estrategias para implementar el sistema CRISPR/Cas9 en células fúngicas

Para poder realizar la edición del genoma mediada por el sistema CRISPR/Cas9, tanto la endonucleasa como el sgRNA, deben estar presentes en el núcleo del organismo objetivo. En el caso de los hongos filamentosos, los métodos más comunes de transformación génica incluyen la transformación mediada por polietilenglicol (PEG), la transformación mediada por agrobacterias (AMT, por sus siglas en inglés Agrobacterium-mediated transformation) (Song et al., 2019) y la transformación mediada por electroporación (Schuster et al., 2019; Song et al., 2019). Los componentes del sistema CRISPR/Cas9 ingresan a las células fúngicas mediante vectores que portan casetes de expresión de CAS9 y sgRNA. Por lo general, estos casetes pueden ser transportados por un solo vector que transporte ambos casetes o por dos vectores que transportan un casete cada uno. Sin embargo, Zhang y colaboradores  (2016) mostraron en Aspergillus fumigatus que la precisión y eficiencia del uso de un sistema de expresión de vector único es significativamente mayor que el sistema de expresión de vector doble. (Liu et al., 2015; Chen et al., 2017; Kuivanen et al., 2016; Kuivanen et al., 2017). Hasta la fecha, se han descrito principalmente cuatro estrategias para establecer el sistema CRISPR/Cas9 en hongos filamentosos (Figura 2): la integración de CAS9 en el genoma fúngico, la expresión transitoria (TE, por sus siglas en inglés, Transient Expression) de CAS9, la utilización de plásmidos de replicación autónoma (no integrativos) y el uso de ribonucleoproteínas (RNPs).

 – Integración de CAS9 y sgRNA en sistemas de expresión transitoria (TE)

T. reesei fue el hongo filamentoso en el que se implementó el sistema CRISPR/Cas9 por primera vez, mediante AMT y utilizando un gen CAS9 con codones optimizado. La integración exitosa del gen CAS9 generó una cepa que requería únicamente el sgRNA para la edición del genoma, proporcionando un método dirigible rápidamente a múltiples genes simultáneamente (Liu et al., 2015), como se detalla en la Figura 2A. Sin embargo, la integración aleatoria del gen CAS9 en el genoma del huésped puede inducir mutaciones no deseadas.

Obtener una cepa fúngica que exprese Cas9 puede requerir, además de la detección de varios transformantes, la optimización del uso de codones del gen CAS9, el cual será diferente para cada especie hospedadora estudiada. Para poder superar estas limitaciones, se han utilizado sistemas TE de CAS9 y sgRNA en hongos filamentosos (Figura 2B). Matsu-ura y colaboradores (2015) desarrollaron un sistema CRISPR/Cas9 de expresión transitoria en el hongo filamentoso modelo Neurospora crassa, en el cual no existió ningún problema en la expresión de la endonucleasa y del sgRNA, lo que sugiere que la estrategia es eficiente y podría aplicarse a otros hongos filamentosos. Posteriormente, se realizaron trabajos con hongos que tenían múltiples núcleos, como el hongo filamentoso fitopatógeno Sclerotinia sclerotiorum. CAS9 y sgRNA pudieron expresarse de forma transitoria en los protoplastos y funcionar correctamente. Sin embargo, fragmentos de plásmidos de varios tamaños se integraron en el sitio de escisión de Cas9/sgRNA por la vía de reparación NHEJ generando mutantes con inserciones de plásmidos (Li et al., 2018).

CRISPR hongos
Figura 2. Principales estrategias para implementar la técnica CRISPR/Cas9 en hongos filamentosos. A) Integración del gen CAS9 en el genoma del hongo filamentoso por transformación mediada por A. tumefaciens. El sgRNA es transcrito in vitro e implementado en protoplastos de hongos. Esta estrategia permite la edición múltiple del genoma con múltiples sgRNAs dirigidos a distintos blancos. (B-D) Estrategias que no integran el gen CAS9 en el genoma de hongos filamentosos. B) Expresión transitoria de CAS9 mediada por plásmidos que codifican el sgRNA y CAS9. C) Plásmidos de replicación autónoma (e.g. AMA1) que codifican el sgRNA y CAS9 generan una mayor probabilidad de expresión y edición por su mejor estabilidad en el interior de protoplastos fúngicos. D) Implementación de CRISPR/Cas9 por complejos de ribonucleoproteínas (RNP). Cas9 y sgRNA son ensamblados in vitro e introducidos en los protoplastos.

 

 – Plásmidos de replicación autónoma

Debido a que los hongos filamentosos no pueden mantener estables la mayoría de los plásmidos, varios replicadores cromosómicos como AMA1 y MATE han proporcionado un posible mecanismo para el mantenimiento extracromosómico de plásmidos en hongos filamentosos, como se muestra en la Figura 2C. Los plásmidos portadores del fragmento AMA1 poseen algunas ventajas, que incluyen el mejoramiento significativo en la transformación y la baja probabilidad de ser insertados en el genoma fúngico durante la transformación. Uno de los primeros estudios en utilizar este método fue descrito por Nodvig  y colaboradores (2015), quienes silenciaron el gen yA en A. nidulans, provocando un cambio de color en los conidios de amarillo a verde.

 

Estrategias de selección de transformantes positivos: marcadores más empleados

Cuando se desea modificar el genoma de un organismo, en general, es determinante diseñar una estrategia de detección que permita confirmar dicha transformación. Es decir, desarrollar el mecanismo adecuado para la selección eficiente y eficaz de los transformantes positivos. Como indica su nombre, los marcadores de selección permiten distinguir aquellos organismos sobre los cuales la transformación de su genoma fue ejecutada correctamente. En hongos filamentosos, existe una extensa variedad de marcadores funcionales de selección, los cuales se pueden clasificar en dos grandes grupos: marcadores de selección dominante y marcadores de auxotrofía (i.e. la auxotrofía de algún aminoácido, restauración de pigmentación, habilidad de emplear alguna fuente de nitrógeno, etc.). Por ejemplo, entre los marcadores de selección más comunes que confieren resistencia a antibióticos destacan: hph, bar, nptII, ip, nat y ble, que confieren resistencia a la higromicina B, bialaphos, G418 (geneticina), carboxina, nourseothricina y bleomicina, respectivamente. Entre los marcadores de selección más empleados que restauran auxotrofías predominan: pyrG/pyr4, argB, y amdS, los cuales restauran la auxotrofía a uracilo, arginina o confieren la capacidad de utilizar acetamida como única fuente de nitrógeno, respectivamente.

Los resultados obtenidos en la presente revisión, muestran que el marcador de selección más empleado en los sistemas CRISPR/Cas9 en hongos filamentosos es el hph con un 29.7% (Figura 3A), el cual confiere resistencia a la higromicina (Nødvig et al., 2015; Li et al., 2018; Darma et al., 2019). Sin embargo, los genes de resistencia a antibióticos no son recomendados en construcciones de cepas industriales, debido a que, en la mayoría de los países, las autoridades reguladoras se oponen al uso de los mismos por el riesgo potencial que estos representan a la salud humana. Además, sostienen que la propagación de cepas fúngicas que portan casetes de resistencia a antibióticos podría llegar a generar resistencia a gran escala en la sociedad humana. Es por ello que, convenientemente, se emplean marcadores de selección que restauren algún fenotipo determinado mediante la inserción estratégica en la cepa parental por procesos de mutación al azar o de ingeniería genética.

El segundo marcador de selección más empleado que se ha identificado es el gen pyrG con un 14.1% (Figura 3A). Dicho gen codifica la orotidina-5′-monofosfato decarboxilasa, una enzima implicada en la biosíntesis del aminoácido uracilo. Cuando se aplica el sistema CRISPR/Cas9 para la edición del genoma en una cepa de hongo filamentoso cuyo gen pyrG está inactivo (que confiere auxotrofía de uracilo), el gen pyrG es usado como marcador homólogo de selección. Cuando se introduce el DSB por la ribonucleasa Cas9 y se suministra una copia del gen pyrG (flanqueado con los brazos homólogos a la región donde ocurrió la incisión), se activa el mecanismo de reparación HDR. Así, el hongo que haya incorporado la copia funcional del gen pyrG será capaz de crecer en un medio de cultivo mínimo que no haya sido suplementado con uridina, pues ya habrá complementado la auxotrofía y volverá a ser protótrofo (Matsuda et al., 2018; Katayama et al., 2019; Kuivanen et al., 2019). Este es el principio fundamental en el que se basan todos los marcadores de selección destinados a restaurar una auxotrofía determinada.

 

Estrategias para la expresión del gen CAS9 en hongos filamentosos: promotores más empleados

La aplicación eficiente del sistema CRISPR/Cas9 requiere de la expresión heteróloga del gen CAS9 fusionado a una secuencia NLS (por sus siglas del inglés, Nuclear Localization Signal), así como también de la expresión simultánea del sgRNA. Tomando en cuenta estas dos consideraciones, se han establecido dos estrategias principales para la expresión del gen CAS9: in vitro e in vivo (Shi et al., 2017). En el primer caso, CAS9 y sgRNA son transcritos simultáneamente in vitro y luego forman el complejo de RNP Cas9/sgRNA para editar los genes diana. Dicha estrategia fue inicialmente evaluada y reportada por Pohl   y colaboradores (2016) en Penicillium chrysogenum. En cambio, cuando se desea expresar el gen CAS9 in vivo, con frecuencia se emplea el gen CAS9 de S. pyogenes con el uso de codones optimizados para humanos (hSpCas9) fusionado a una NLS del virus 40 vacuolado del simio (SV40 NLS: 5’… CCCAAGAAGAAGAGGAAGGTG…3’) (Shi et al., 2017). Sin embargo, al ser una construcción general y relativamente simple, esta estrategia no es adecuada para todos los organismos de estudio. Es por ello que, con el fin de mejorar y asegurar la precisión y la eficiencia de edición de genomas, algunos investigadores han preferido optimizar las secuencias de CAS9 y NLS en función del uso de codones específico de los hongos filamentosos sobre los cuales se desea realizar la edición genómica (Tabla 3). En otros casos, los investigadores han escogido seleccionar directamente un NLS más fuerte para dirigir de manera eficiente la proteína de fusión al núcleo de la célula (Matsu-Ura et al., 2015; Fuller et al., 2015; Shi et al., 2017).

Además, la exitosa expresión heteróloga del gen CAS9 depende del tipo de promotor utilizado. La activación con la que los promotores dirigen la transcripción es un factor importante que afecta a la eficiencia de expresión de los genes exógenos, como es, en este caso, la expresión del gen CAS9. Por esta razón, la selección de un promotor adecuado es de gran importancia para un funcionamiento eficiente del sistema CRISPR/Cas9 (Song et al., 2019). Una amplia gama de promotores ha sido evaluada para la expresión de CAS9 en hongos filamentosos. De estos, los promotores constitutivos son usados con mayor frecuencia.

En este trabajo, los resultados muestran (Figura 3B) que entre los promotores más empleados en los sistemas de expresión heteróloga destacan: el promotor del gen tef1 que codifica el factor 1α de elongación de la traducción de A. nidulans (39.1%), el promotor del gen gpdA que codifica la gliceraldehído-3-fosfato deshidrogenasa de A. nidulans (8.3%) y el promotor del gen trpC de la biosíntesis de triptófano de A. nidulans (8.3%) (Arazoe et al., 2015; Matsu-Ura, 2015 et al.; Zhang et al., 2016). No obstante, esta última estrategia no permite controlar la estabilidad del sistema CRISPR/Cas9 en hongos filamentosos y, por tanto, existe la posibilidad de obtener off-targets en loci distintos del genoma al que se desea editar (Shi et al., 2017).

Para tener un mayor control sobre el sistema CRISPR/Cas9, se han empleado algunos promotores inducibles en hongos filamentosos, tales como: el promotor del gen amyB que codifica la TAKA-amilasa A de A. oryzae, el cual es inducido por almidón o maltosa y reprimido por glucosa; el promotor del gen cbh1 que codifica una celobiohidrolasa I de T. reesei, el cual es inducido por una serie de oligosacáridos o celulosa y reprimido por glucosa; el promotor del gen glaA, que codifica una glucoamilasa de A. niger que es inducido por glucosa y reprimido por xilosa; el promotor del gen niiA que codifica la nitrito reductasa de A. nidulans, el cual es inducido por nitrato y reprimido por amonio y el promotor del gen xlnA, que codifica una endoxilanasa de A. nidulans, el cual es inducido por xilosa o xilano y reprimido por glucosa (Liu et al., 2015a; Zhang et al., 2016; Katayama et al., 2016; Pohl et al., 2016; Zheng et al., 2018), entre otros. Así mismo, L. Naranjo (comunicación personal), propone el empleo del promotor inducible del gen oat1 que codifica una ornitina w-aminotransferasa en P. chrysogenum Wisconsin 54-1255, el cual se induce fuertemente por L-lisina, L-ornitina y L-arginina y se reprime por amonio (Naranjo et al., 2004). Las ventajas comparativas de este tipo de promotores inducibles es que permiten controlar la expresión del gen CAS9 con el fin de minimizar el número de off-targets y el consecuente mosaicismo en las cepas transformadas.

 

Estrategias para la expresión del sgRNA en hongos filamentosos: promotores más empleados

La expresión del sgRNA se puede realizar por dos vías: in vivo o in vitro. Para la expresión in vivo, se han desarrollado dos estrategias principales que se basan en el empleo de los promotores de la RNA polimerasa II o la RNA polimerasa III. Por ejemplo, U6 es un tipo de promotor endógeno para la RNA polimerasa III (Pol III) y genes de snRNA (por sus siglas del inglés small nuclear RNA) (Ryan y Cate, 2014). Para poder identificarlos y luego emplearlos en hongos filamentosos, es necesario comparar las secuencias snRNA entre distintas especies, cuyos promotores U6 ya han sido identificados previamente, con el fin de encontrar aquellas con al menos un 65% de identidad y, posteriormente, evaluar si efectivamente son capaces de transcribir de manera eficiente el sgRNA (Katayama et al., 2016; Schuster et al., 2016; Zhang et al., 2016). Adicionalmente, también se ha empleado el promotor del gen SNR52 que, al igual que U6, también es un promotor endógeno de la Pol III (Fuller et al., 2015; Matsu-Ura et al., 2015; Min et al., 2016; Shapiro et al., 2018; Vyas et al., 2018).

Sin embargo, esta estrategia de expresión de sgRNA puede resultar compleja porque algunos promotores endógenos de RNA polimerasa II (Pol II) de hongos filamentosos son actualmente difíciles de identificar en el genoma o no son adecuados para la transcripción de sgRNAs. En otros casos, los promotores U6 no son conservados en el genoma del organismo de interés, como es el caso de Ustilaginoidea virens. En dicho hongo, como sustituto del promotor U6 (ausente en el genoma), se utilizó la secuencia promotora del gen Gln-tRNA como promotor de la Pol III (Liang et al., 2018). Es por ello, que se desarrolló otra estrategia basada en promotores de la Pol II. En este sentido, Nødvig y colaboradores (2015) emplearon dos secuencias de ribozimas: 5′-end hammerhead (HH) y 3′-end virus hepatitis delta (HDV), con la finalidad de flanquear el sgRNA y permitir su transcripción in vivo. Finalmente, para asegurar una robusta transcripción de la secuencia que contiene el sgRNA, este grupo de investigación utilizó el promotor fuerte del gen constitutivo gpdA en A. nidulans (PgdpA). Esta importante investigación obtuvo como producto final la construcción de cuatro plásmidos CRISPR/Cas9 funcionales para la edición de genomas de hongos filamentosos: pFC330, pFC331, pFC332, pFC333 (disponibles en el repositorio de plásmidos de Addgene), los cuales poseen distintos marcadores de selección: pyrG, argB, hbh y ble, respectivamente. Estos plásmidos, que usan PgdpA como promotor de la Pol II, han sido usados ampliamente en numerosas investigaciones. Cabe destacar que, adicionalmente al PgdpA, también se ha empleado el promotor del gen utp25, el cual codifica una proteína U3 asociada a snRNA y es reconocido como un promotor de la Pol II (Van den Berg et al., 2008; Pohl et al., 2016). Así, los tres promotores para la expresión in vivo del sgRNA más empleados que hemos identificado en la presente investigación son U6 (34.1%), PgdpA (31.7%) y SNR52 (14.6%). Estos resultados sobre los promotores más empleados para la expresión de sgRNAs en hongos filamentosos se muestran en la Figura 3C. Además de las estrategias de expresión del sgRNA in vivo mencionadas anteriormente, también se han empleado estrategias de transcripción in vitro en las que se emplean específicamente los promotores U6 o T7 (Tabla 3).

 

Tabla 3. Estrategias para la expresión del gen CAS9, sgRNA y marcadores de selección para la edición de genomas de hongos filamentosos.

Especie Expresión de sgRNA Expresión de Cas9 Marcador de selección Tipo de replicación Método de transformación Método de edición Eficiencia Referencia
Trichoderma reesei Transcrito in vitro pdc, cbh1 (codón optimizado) ura5 TEg PMTf NHEJe/HDRd 93%/4.2-45% Liu et al., 2015
Pyricularia oryzae U6, trpC tef1 (codón optimizado) bar TE PMT NHEJ/HDR 36.1-80.5 Arazoe et al., 2015
Aspergillus spp. gdpA tef1 (pFC330, pFC331, pFC332, pFC333) pyrG, argB, hph, ble AMA1a PMT NHEJ Nødvig et al., 2015
Neurospora crassa SNR52 trpC (codón optimizado) bar TE PMT NHEJ/HDR Matsu-Ura et al., 2015
Aspergillus fumigatus SNR52 tef1 (hSpCas9) hph, ble TE PMT NHEJ 25%-53% Fuller et al., 2015
Phytophthora sojae RPL41 Ham34 (hSpCas9) nptII TE PMT NHEJ/HDR Fang y Tyler 2016
Ustilago maydis U6 Otef (tef1 modificado), hsp70 (codón optimizado) ip ARSc PMT NHEJ 50%-90% Schuster et al., 2016
Aspergillus fumigatus U6 niiA, gpdA (hSpCas9) pyr4, hph AMA1 PMT HDR 95%-100% Zhang et al., 2016
Aspergillus oryzae U6 amyB (codón optimizado) pyrG TE PMT NHEJ 10%-20% Katayama et al., 2016
Penicillium chrysogenum U6, utp25 xlnA (hSpCas9) amdS AMA1/TE PMT NHEJ/HDR 100% Pohl et al., 2016
Candida albicans SNR52 ENO1 (codón optimizado) Nat TE Lithium acetate NHEJ/HDR Min et al., 2016
Aspergillus niger gdpA tef1 (pFC332) pyrG, hph AMA1 PMT NHEJ/HDR 37-5%-100% Kuivanen et al., 2016
Aspergillus fumigatus gdpA TetON (pFC332) pyrG AMA1 PMT NHEJ/HDR Weber et al., 2016
Leptosphaeria maculans act1 act1 (codón optimizado) ip, nptII, hph AMTb NHEJ Idnurm et al., 2017
Coprinopsis cinerea U6 CcDED1 (codón optimizado para basidiomycete) gfp Electroporación NHEJ 10.5 Sugano et al., 2017
Myceliophthora thermophila U6 tef1 (codón optimizado) bar TE PMT/AMT NHEJ/HDR 15%-95% Liu et al., 2017
Myceliophthora heterothallica
Talaromyces atroroseus gdpA tef1 (pFC330) hph AMA1 PMT NHEI Nielsen et al., 2017
Aspergillus carbonarius gdpA tef1 (pFC332) hph AMA1 AMT NHEJ/HDR 27% Weyda et al., 2017
Aspergillus niger gdpA tef1 (pFC332)

 

hph AMA1 PMT NHEJ Kuivanen et al., 2017
Beauveria bassiana Transcrito in vitro gdpA (codón optimizado) gfp, ura5, bar PMT NHEJ/HDR 5%-50% Chen et al., 2017b
Alternaria alternata gdpA gdpA (pFC332) pyr4, hph AMA1 PMT NHEJ Wenderoth et al., 2017
Shiraia bambusicola U6 trpC (codón optimizado) hph PMT NHEJ Deng et al., 2017b
Shiraia bambusicola U6 trpC (codón optimizado) hph PMT NHEJ/HDR 32% Deng et al., 2017c
Nodulisporium sp. U6, T7 trpC (codón optimizado) bar TE PMT NHEJ/HDR Zheng et al., 2017
Mucor circinelloides Transcrito in vitro SpCas9 pyr4 TE PMT NHEJ/HDR 100% Nagy et al., 2017
Ustilago maydis U6 Otef (tef1 modificado), hsp70 (codón optimizado) ip ARS PMT NHEJ 50%-100% Schuster et al., 2018
Fusarium graminearum tef1 gdpA (codón optimizado) fludioxonil PMT NHEJ/HDR 1%-10% Gardiner y Kazan, 2018
Aspergillus niger gdpA tef1 (pFC332) hph AMA1 PMT NHEJ Kuivanen y Richard, 2018
Candida albicans SNR52 SpCas9 Nat, Phloxine B Electroporación NHEJ 53%-98% Shapiro et al., 2018
Aspergilli gdpA tef1 (pFC332)

 

arg, pyrG AMA1 AMT HDR 15%-90% Nødvig et al., 2018
B. dermatitidis gdpA tef1 (pFC332) hph AMA1 AMT NHEJ 22%-73% Kujoth et al., 2018
Aspergillus niger U6 glaA (pFC332, codón optimizado) hph, amdS AMA1 PMT NHEL/HDR 33.3%-100% Zheng et al., 2018
Candida albicans SNR52 ENO1 (codón optimizado) Nat ARS Electroporación HDR 25%-100% Vyas et al., 2018
Phytophthora sojae RPL41 Ham34 (hSpCas9) nptII TE PMT NHEJ Miao et al., 2018
Fusarium oxysporum Transcrito in vitro pFC332 hph AMA1 PMT NHEJ/HDR 20%-53.8% Wang et al., 2018a
Ustilaginoidea virens Gln-tRNA pdc, cbh1 (codón optimizado) nptii AMT PMT NHEJ Liang et al., 2018
Cordyceps militaris T7 tef1 (codón optimizado) 5-FOA, blcR AMT/PMT NHEJ/HDR Chen et al., 2018
Cryptococcus neoformans U6 tef1 (codón optimizado) Ntc Electroporación HDR 96.5%-100% Wang et al., 2018b
Sclerotinia sclerotiorum T7 tef1 (hSpCas9) hph PMT NHEJ/HDR 38%-100% Li et al., 2018
Aspergillus novofumigatus gdpA tef1 (pFC332) pyrG AMA1 PMT NHEJ Matsuda et al., 2018
Aspergillus niger gdpA tef1 (pFC332) argB, pyrG AMA1 PMT HDR 100% Leynaud-Kieffer et al., 2019
Aspergillus oryzae U6 amyB (codón optimizado) pyrG PMT HDR 50%-100% Katayama et al., 2019
Alternaria alternata gdpA tef1 (pFC332) hph AMA1 PMT NHEJ Igbalajobi et al., 2019
Aspergillus niger Transcrito in vitro codón optimizado pyrG PMT NHEJ/HDR 100% Kuivanen et al., 2019
Mucor circinelloides Transcrito in vitro SpCas9 pyr4 PMT HDR 100% Nagy et al., 2019
Leptosphaeria maculans act1 act1 (hSpCas9) hph AMT NHEJ Darma et al., 2019
Ashbya gossypii SNR52 tef1 (hSpCas9) nptII Electroporación NHEJ 44%-85% Jiménez et al., 2019
Duddingtonia flagrans Transcrito in vitro tef1 (pFC332) hph AMA1 PMT HDR Youssar et al., 2019

a:  Apical Membrane Antigen 1; b:  Agrobacterium-mediated transformation; c:  Autonomously Replicating Sequence; d:  Homology-Directed Repair; e: Non-homologous end joining; f:   Protoplast-mediated transformation; g:  Transient Expression.

 

Los autores Liu y colaboradores (2015a) realizaron el primer sistema CRISPR/Cas9 para edición del genoma de T. Reesei. En este sistema, se empleó el promotor T7 para la expresión in vitro del sgRNA y los promotores cbh1 o pdc, Pcgh1 y Ppdc. Además, para la expresión heteróloga de CAS9, los autores optimizaron el uso de codones para T. reesei y, como marcador de selección, emplearon el gen hph que confiere resistencia a la higromicina. La transformación se realizó en un plásmido TE alcanzando una eficiencia de edición entre 93 y 100%.

En otro ejemplo, Pohl  y colaboradores (2016) desarrollaron un repertorio de herramientas moleculares para la edición del genoma en P. chrysogenum tanto in vivo como in vitro. Mientras que el gen hcas9 funcional en humanos fue expresado in vivo bajo el control del promotor inducible del gen xlnA, el sgRNA fue expresado in vivo e in vitro bajo el control del promotor T7. Como marcador positivo de selección de transformantes, los autores emplearon el gen amdS que confiere la capacidad de utilizar acetamida como única fuente de carbono y energía (Kelly y Hynes, 1985). Los plásmidos de transformación evaluados por los autores fueron de replicación autónoma (AMA1) y de expresión transitoria. Los resultados obtenidos con el sistema propuesto mostraron una eficiencia de modificación del genoma entre 33-100%.

Alternativamente, Zhang y colaboradores (2016) propusieron el uso de un sistema CRISPR/Cas9 que expresaba sgRNA in vitro y bajo el control del promotor U6 en la especie A. fumigatus. En este caso, se empleó un gen CAS9 con uso de codones optimizado para humanos expresada bajo el control del promotor Ptef1. Como marcadores de selección, se utilizaron el gen pyr4 (restauración de la auxotrofía de uracilo) y el gen hph que confiere resistencia a la higromicina en plásmidos de replicación autónoma, alcanzando un porcentaje de modificación de entre 95 y 100%. En otro caso, con A. fumigatus, Weber y colaboradores (2016) expresaron el gen CAS9 bajo el promotor inducible TetON y se empleó la auxotrofía de uridina/uracilo (pyrG) como marcador de selección. Los plásmidos de transformación contenían la región AMA1 para una replicación autónoma, logrando eficiencias de edición de hasta un 80%.

La Figura 3 muestra los marcadores de selección positiva de transformantes y los promotores más empleados en los sistemas CRISPR/Cas9 en hongos filamentosos que se han descrito en la literatura científica indexada entre los años 2015-2020.

 

 

CRISPR hongos
Figura 3. Marcadores de selección positiva de transformantes y promotores empleados en los sistemas CRISPR/Cas9 en hongos filamentosos: A) marcadores de selección dominantes y de auxotrofía, B) promotores para la expresión heteróloga del gen CAS9, y C) marcadores para la expresión de sgRNAs. Gráfico fundamentado en los artículos analizados en esta revisión (2015-2020).

 

Complejos de ribonucleoproteínas (RNPs)

Para la optimización de todos los sistemas CRISPR/Cas9 en hongos filamentosos se requiere una cantidad considerable de tiempo y esfuerzo. En consecuencia, los intentos más recientes han utilizado un método de entrega basado en un complejo de ribonucleoproteína (RNP) Cas9:sgRNAs para la edición del genoma en diferentes especies, tales como Arabidopsis, la mosca de la fruta, el pez cebra y en líneas celulares humanas. Las RNPs consisten en una proteína Cas9 purificada a homogeneidad y un sgRNA transcrito sintetizado in vitro, formando un complejo que posteriormente se transfecta directamente en las células huésped (Figura 2D).

En comparación con el uso de plásmidos, los complejos RNPs Cas9:sgRNAs presentan varias ventajas. La expresión del gen CAS9 y la transcripción del sgRNA no dependen de la maquinaria del huésped, los RNPs ensamblados tienen actividad de escisión inmediata y la eficiencia de escisión de los diferentes sgRNAs puede probarse in vitro permitiendo elegir los sgRNAs más adecuados. Las RNPs se agotan en un periodo corto de tiempo de las células huésped mediante la vía de degradación de proteínas, reduciendo de esta manera la posibilidad de actividad fuera del objetivo de Cas9 (Wang et al., 2019).

El método CRISPR/Cas9 basado en RNPs Cas9:sgRNAs se ha utilizado en varias especies de hongos filamentosos. Un estudio reciente utilizó dos cepas de A. fumigatus (WT y ΔakuB) para emplear el mecanismo de reparación HDR mediado por el sistema CRISPR/Cas9 con el objetivo de alterar el gen pksP, responsable del color verde de los conidios. Como resultado, ambas cepas mostraron el fenotipo deseado, obteniendo un 97% de eficiencia en la cepa ΔakuB, mientras que en la cepa WT se estuvo una eficiencia entre 40 y 74% (Al Abdallah et al., 2017). En otro estudio, se desarrolló un método de deleción genética en el hongo fitopatógeno Fusarium proliferatum (Ferrara et al., 2019). En este sistema se realizó una ruptura de doble cadena de ADN mediada por dos RNPs con recombinación de microhomología. Este sistema redujo el riesgo de mutaciones fuera del objetivo y minimizó el riesgo de alterar cualquier gen adyacente al gen objetivo. En este estudio, se eliminó el gen FUM1 requerido para la biosíntesis de la micotoxina fumonisina. Tras la cuantificación de fumonisina en los transformantes positivos, se determinó que ninguna de las cepas mutantes presentó cantidades detectables de esta micotoxina (Ferrara et al., 2019).

Se han descrito varios métodos basados en complejos de RNPs Cas9:sgRNA en otras especies de hongos filamentosos como P. chrysogenum, Mucor circinelloides, Magnaporthe oryzae y Fusarium oxysporum (Pohl et al., 2018; Nagy et al., 2017; Foster et al., 2018; Wang et al., 2018). En conjunto, estos estudios indican que el establecimiento del sistema CRISPR/Cas9 mediado por RNPs tiene cada vez más aplicaciones en la edición de genomas de hongos filamentosos por su alta eficiencia y versatilidad.

 

CRISPRi y CRISPRa EN HONGOS FILAMENTOSOS

La flexibilidad del sistema CRISPR/Cas9 para la manipulación del genoma ha permitido el desarrollo de nuevas alternativas para la interferencia (CRISPRi) y activación (CRISPRa) de genes. Estos nuevos sistemas pueden regular la expresión transcripcional y están basados en una endonucleasa Cas9 mutada (dCas9, por sus siglas en inglés nuclease-dead Cas9) que ha perdido su actividad mediante la inactivación de sus dominios RuvC y HNH. La dCas9 está dirigida a regiones promotoras específicas a través del sgRNA, para lograr el impedimento estérico de la ARN polimerasa bloqueando de esta manera el inicio o alargamiento de la transcripción (Wang et al., 2019). Además, dCas9 puede fusionarse con represores o activadores transcripcionales para disminuir o aumentar la expresión génica, respectivamente.

En el caso de CRISPRa, Roux y colaboradores (2020) utilizaron un sistema CRISPR/dLbCas12a-VPR para la activación de un grupo de genes biosintéticos fúngicos (BGC) en la especie Aspergillus nidulans, tales como el gen nativo micA que codifica una enzima tipo péptido no ribosómico, responsable de la biosíntesis de la microperfuranona. Los autores utilizaron sistemas CRISPRs direccionados a dos loci. Mediante análisis cuantitativos, los autores determinaron que la implementación de estos sistemas condujo a un incremento significativo en la biosíntesis de microperfuranona en A. nidulans, respecto a los controles. En el hongo levaduriforme Candida albicans se han aplicado sistemas represores y activadores transcripcionales basados en CRISPR, fusionando la enzima dCas9 a dominios de activación transcripcionales Gal4 y/o VP64, y con el represor Nrg1, demostrando la regulación específica del gen codificante de catalasa citosólica CAT1 (Román et al., 2019).

En C. albicans también se ha empleado CRISPRi a través de un sistema optimizado CRISPRi dCas9-Mxi1, con la finalidad de reprimir la expresión del gen HSP90 que codifica una chaperona molecular esencial en esta levadura. En la fase experimental del estudio, se emplearon dos sgRNA distintos para cada cepa, teniendo como resultado que ambas cepas positivas dCas9 mostraron fenotipos que corresponden a la disminución de HSP90 (Wensing et al., 2019). Estos estudios evidencian que los sistemas CRISPRi y CRISPRa presentan un alto potencial y una valiosa expansión en el creciente repertorio de herramientas moleculares CRISPR para hongos filamentosos.

 

CONCLUSIONES Y PERSPECTIVAS

A medida que transcurre el tiempo se consolida cada vez más la importancia industrial que tienen los hongos filamentosos como factorías celulares en la producción de una ilimitada variedad de productos de alto valor biotecnológico. Además de contribuir a la descarbonización neta de la economía, contribuir a la mitigación del cambio global en su bioproceso y a la economía circular, estos productos han mostrado ser económicamente rentables, socialmente justos y ecológicamente viables. Estos microorganismos cosmopolitas, que nos han acompañado desde tiempos ancestrales, poseen un alto valor estratégico en diversas áreas, tales como la salud humana y animal, la alimentación, el desarrollo de nuevos biomateriales y biomoléculas, la implementación de una agricultura bajo un enfoque agroecológico, la generación de nuevas fuentes de bioenergía y la biocatálisis ambiental, entre otros sectores. Todas estas áreas son ecológicamente trascendentales para preservar la vida en sobre el planeta Tierra.

El estudio y la aplicación del sistema CRISPR/Cas9 como herramienta de edición genómica de hongos filamentosos ha abierto una brecha sin retorno que brinda un sinfín de posibilidades, donde el límite está solamente en la imaginación del investigador. Debido a la flexibilidad del sistema CRISPR/Cas9, se han desarrollado diferentes alternativas, como los sistemas CRISPRi y CRISPRa, que presentan a futuro una prometedora estrategia de regulación transcripcional en hongos filamentosos. Además de la gran variedad de sistemas, la tecnología CRISPR/Cas puede ampliar sus fronteras moleculares implementando nucleasas diferentes a Cas9, como es el caso de las endonucleasas Cpf1 y nickasas.

En relación a las estrategias tecnológicas que han predominado para obtener una mayor frecuencia de modificación genética y como consecuencia una mayor probabilidad de modificación genómica, se han desarrollado las siguientes tendencias. Respecto al uso de marcadores positivos de selección de transformantes, se ha evidenciado la utilización con mayor frecuencia del gen hph (29.7%), el cual confiere resistencia a la higromicina, seguido por el grupo de genes pyrG/pyr4/ura5/ura3 que restaura la auxotrofía de uracilo (24.4%). En los mecanismos de expresión heteróloga del gen CAS9, existe una clara tendencia en la utilización del promotor Ptef1 (39.6%), aunque provoca una fuerte expresión aumentando de esta manera las posibilidades de producir off-targets. Es por ello que existe un gran interés en estudiar y aplicar promotores inducibles, tales como amyB, cbh1, niiA, glaA y xlnA, con el fin de controlar/modular la expresión del gen CAS9 y reducir la generación de off-targets y concomitante mosaicismo. Referente a los mecanismos de expresión del sgRNA, se observa una clara inclinación por la expresión in vivo con el uso del promotor U6 (34.1%), un tipo de promotor endógeno para la RNA polimerasa III. Para la expresión in vitro del sgRNA en hongos filamentosos, se ha optado por emplear vectores de expresión bajo el control de los promotores U6 o T7, a pesar de que esta estrategia ha sido muy poco utilizada hasta la fecha (2.4%).

La edición de genomas de hongos filamentosos empleando CRISPR/Cas9 ha tenido un crecimiento sostenido desde su origen, dícese en los últimos 5 años, pues cada vez se han obtenido mejores eficiencias de transformación empleando una variedad importante de promotores constitutivos e inducibles. Sin embargo, aún existen numerosos promotores inducibles que no han sido evaluados hasta la fecha y que podrían solucionar inconsistencias que han surgido en la edición de genomas de ciertos hongos filamentosos. Además, la lista de genomas secuenciados de estos microorganismos ha aumentado vertiginosamente, lo que abre oportunidades para nuevos desafíos orientados al diseño de nuevas herramientas moleculares basados en CRISPR/Cas9. Esto, a su vez, exige seguir perfeccionando las herramientas bioinformáticas y algoritmos disponibles para el diseño de los sgRNAs con el fin de disminuir los off-targets y las probabilidades de error en la edición de genomas de hongos filamentosos.

 

CONFLICTO DE INTERESES

Los autores del trabajo manifiestan ningún conflicto de interés relacionado.

 

Bibliografía

Abbas H.K., et al. Selection of Aspergillus flavus Isolates for Biological Control of Aflatoxins in Corn. Toxin Reviews. 2011 Jun 19; 30, 59-70. doi: 10.3109/15569543.2011.591539

Ahmed H., et al. First Report: Penicillium adametzioides, a Potential Biocontrol Agent for Ochratoxin-Producing Fungus in Grapes, Resulting from Natural Product Pre-Harvest Treatment. Food Control, 2015 May 1; 51, 23-30. doi: 10.1016/j.foodcont.2014.10.034

Al Abdallah Q., et al. A simple and universal system for gene manipulation in Aspergillus fumigatus: in vitro-assembled Cas9-guide RNA ribonucleoproteins coupled with microhomology repair templates. mSphere; 2017; 2(6).

Arazoe T., et al. Tailor-made CRISPR/Cas system for highly efficient targeted gene replacement in the rice blast fungus. Biotechnol. Bioeng. 2015 Jun 3; 112(12), 2543–2549. doi: 10.1002/bit.25662

Chen B.-X., et al. Efficient CRISPR-Cas9 Gene Disruption System in Edible-Medicinal Mushroom Cordyceps militaris. Frontiers in Microbiology. 2018 Jun 12; 9. doi:10.3389/fmicb.2018.01157

Chen H, et al. Cut Site Selection by the Two Nuclease Domains of the Cas9 RNA-guided Endonuclease. J Biol Chem. 2014 May 9;289(19):13284-94. doi: 10.1074/jbc.M113.539726.

Chen J., et al. CRISPR/Cas9-mediated efficient genome editing via blastospore-based transformation in entomopathogenic fungus Beauveria bassiana. Sci. Rep. 2017b Apr 3; 8, 45763. doi: 10.1038/srep45763

Chen W., et al. Orange, red, yellow: biosynthesis of Azaphilone pigments in Monascus fungi. Chemical Science. 2017a Apr 24;8(7), 4917-4925. doi:10.1039/c7sc00475c

Colvin HJ, et al. Glucose Utilization and Ethanolic Fermentation by Wild-Type and Extrachromosomal Mutants of Neurospora crassa. Journal of Bacteriology. 1973 Dec; 116(3): 1322-8.

Cong L, et al. Multiplex genome engineering using CRISPR/Cas systems. Science (80- ). 2013;339: 819–823. doi:10.1126/science.1231143

Darma R., et al. Identification of a gene cluster for the synthesis of the plant hormone abscisic acid in the plant pathogen Leptosphaeria maculans. Fungal Genetics and Biology. 2019 Apr 25. doi:10.1016/j.fgb.2019.04.015

Davis RH, Perkins DD. Timeline: Neurospora: a model of model microbes. Nat Rev Genet. 2002 May; 3(5): 397-403. doi: 10.1038/nrg797

de Almeida MN, et al. Direct ethanol production from glucose, xylose and sugarcane bagasse by the corn endophytic fungi Fusarium verticillioides and Acremonium zeae. JBiotechnol. 2013 Oct 10; 168(1): 71-7. doi: 10.1016/j.jbiotec.2013.07.032

Deng H., et al. Characterization of a major facilitator superfamily transporter in Shiraia bambusicola. Research in Microbiology. 2017b May 15;168(7), 664–672. doi:10.1016/j.resmic.2017.05.002

Deng H., et al. CRISPR system in filamentous fungi: Current achievements and future directions. Gene. 2017a Sep 5;627, 212–221. doi: 10.1016/j.gene.2017.06.019

Deng H., et al. Genome editing in Shiraia bambusicola using CRISPR-Cas9 system. Journal of Biotechnology. 2017c Oct 10;259, 228–234. doi:10.1016/j.jbiotec.2017.06.1204

Doudna JA, Charpentier E. The new frontier of genome engineering with CRISPR-Cas9. Science (80- ). 2014;346: 1258096. doi:10.1126/science.1258096

Dwiarti L et al. Itaconic acid production using sago starch hydrolysate by Aspergillus terreus Tn484-m1. Bioresour Technol. 2007 Apr 23;98:3329–3337. doi: 10.1016/j.biortech.2006.03.016

Dyal SD, et al. Maximizing the production of γ-linolenic acid in Mortierella ramanniana var. Ramanniana as a function of pH, temperature and carbon source, nitrogen source, metal ions and oil supplementation. Food Res Int. 2005; 38:815–829. doi: 10.1016/j.foodres.2005.04.002

Egbuta M., et al. A Review of the Ubiquity of Ascomycetes Filamentous Fungi in Relation to Their Economic and Medical Importance. Advances in Microbiology. 2016 Dic 28; 06(14), 1140-1158. doi:10.4236/aim.2016.614103

Fakas S, et al. γ-Linolenic acid production by Cunninghamella echinulata, growing on complex organic nitrogen sources. Bioresour Technol. 2008 Dic 3;99:5986–5990. doi: 10.1016/j.biortech.2007.10.016

Fang Y, et al. Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR/Cas9. Mol. Plant Pathol. 2016 Sep 10;17(1), 127–139. doi: 10.1111/mpp.12318

Ferrara M., et al. A CRISPR-Cas9 System for Genome Editing of Fusarium proliferatum. Scientific Reports. 2019; 9(1), 1-9.

Foster A., et al. CRISPR-Cas9 ribonucleoprotein-mediated co-editing and counterselection in the rice blast fungus. Scientific reports. 2018; 8(1), 1-12.

Fraceto, L. F., et al. Trichoderma harzianum -based novel formulations: potential applications for management of Next-Gen agricultural challenges. Journal of Chemical Technology & Biotechnology. 2018 Feb 20; 93(8), 2056–2063. doi:10.1002/jctb.5613

Francis F, et al. Use of response surface methodology for optimizing process parameters for the production of α-amylase by Aspergillus oryzae. Biochem Eng. 2003 Nov 20;J 15:107–115. doi: 10.1016/S1369-703X(02)00192-4

Frisvad J.C., et al. Mycotoxins, Drugs and Other Extrolites Produced by Species in Penicillium Subgenus Penicillium. Studies in Mycology. 2004, 49, 201-241.

Fu B, et al. Target-dependent nickase activities of the CRISPR–Cas nucleases Cpf1 and Cas9. Nature microbiology. 2019; 4(5), 888-897.

Fuller K. K., et al. Development of the CRISPR/Cas9 System for Targeted Gene Disruption in Aspergillus fumigatus. Eukaryot. Cell. 2015 Aug 28;14(11), 1073–1080. doi: 10.1128/EC.00107-15

Gardiner D. M., et al. Selection is required for efficient Cas9-mediated genome editing in Fusarium graminearum. Fungal Biology. 2018 Dic 6;122(2-3), 131–137. doi:10.1016/j.funbio.2017.11.006

Gasiunas G, et al. Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc Natl Acad Sci U S A. 2012 Sep 25;109(39):E2579-86. doi:10.1073/pnas.1208507109

Gheinani AH,  et al. RNA  silencing  of  lactate dehydrogenase gene in  Rhizopus oryzae. J RNAi Gene Silencing. 2011 Jun 20; 7(7): 443-8

Haeussler M, et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome biology 2016 Jul 5;17(1), 148. doi:10.1186/s13059-016-1012-2

Heigwer F, et al. E-CRISP: Fast CRISPR target site identification. Nat Methods. 2014 Jun 30;11(2):122–123. doi: 10.1038/nmeth.2812

Hsu P. D., et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nature biotechnology. 2013 Jul 21;31(9), 827–832. doi:10.1038/nbt.2647

Huang J, et al. Direct ethanol production from lignocellulosic sugars and sugarcane bagasse by a recombinant Trichoderma reesei strain HJ48. The Scientific World Journal. 2014 Jun 2;1–8. doi: 10.1155/2014/798683

Huang L, et al. Highly efficient single base editing in Aspergillus niger with CRISPR/Cas9 cytidine deaminase fusion. Microbiol Res. 2019;223–225: 44–50. doi:10.1016/j.micres.2019.03.007

Idnurm A., et al. Spontaneous and CRISPR/Cas9-induced mutation of the osmosensor histidine kinase of the canola pathogen Leptosphaeria maculans. Fungal Biology and Biotechnology. 2017 Dic 16;4(1). doi:10.1186/s40694-017-0043-0

Igbalajobi O., et al. Red- and Blue-Light Sensing in the Plant Pathogen Alternaria alternata Depends on Phytochrome and the White-Collar Protein LreA. mBio 2019 Apr 9;10(2). doi:10.1128/mbio.00371-19

Jahromi, M.F., et al. Lovastatin Production by Aspergillus terreus Using Agro-Biomass as Substrate in Solid State Fermentation. Journal of Biomedicine and Biotechnology. 2012 Oct 14, 2012:196264. doi: 10.1155/2012/196264

Ji XJ, et al. Fungal arachidonic acid-rich oil: research, development and industrialization. Crit Rev Biotechnol. 2014 Apr 30;34:197–214. doi: 10.3109/07388551.2013.778229.

Jiménez A., et al. Multiplex genome editing in Ashbya gossypii using CRISPR-Cpf1. N Biotechnol. 2020 Jul 25;57: 29–33. doi:10.1016/j.nbt.2020.02.002

Jiménez A., et al. One‐vector CRISPR/Cas9 genome engineering of the industrial fungus Ashbya gossypii. Microbial Biotechnology. 2019 Apr 24. doi:10.1111/1751-7915.13425

Jinek M, et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012 Jun 28; 337(6096), 816–821. doi: 10.1126/science.1225829

Jinek M, et al. Structures of Cas9 endonucleases reveal RNA-mediated conformational activation. Science. 2014 Mar 14;343(6176):1247997. doi:10.1126/science.1247997

Katayama T., et al. Development of a genome editing technique using the CRISPR/Cas9 system in the industrial filamentous fungus Aspergillus oryzae. Biotechnol. Lett. 2016 Dic 19;38(4), 637–642. doi: 10.1007/s10529-015-2015-x

Katayama T., et al. Forced Recycling of AMA1-based Genome-Editing Plasmid Allows for Efficient Multiple Gene Deletion/Integration in The Industrial Filamentous Fungus Aspergillus oryzae. Applied and Environmental Microbiology. 2018 Feb 1; 85(3). doi:10.1128/aem.01896-18

Kaur R., et al. Nonpathogenic Fusarium as a Biological Control Agent. Plant Pathology Journal. 2010; 9, 79-91. doi: 10.3923/ppj.2010.79.91

Kelly J. M. y Hynes M.J. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans. The EMBO Journal 1985; 4(2), 475–479. doi: 10.3923/ppj.2010.79.91

Kim H.K., et al. In vivo high-throughput profiling of CRISPR-Cpf1 activity. Nat Methods. 2017 Dec 19;14: 153–159. doi:10.1038/nmeth.4104

Kleinstiver B.P., et al. High-Fidelity CRISPR-Cas9 Nucleases with No Detectable Genome-Wide Off-Target Effects. Mol Ther. 2016;24: S288. doi:10.1016/s1525-0016(16)33539-0

Komor A. C., et al. CRISPR-Based Technologies for the Manipulation of Eukaryotic Genomes. Cell. 2017 Nov 17;168(1-2), 20–36. doi: 10.1016/j.cell.2016.10.044

Kuivanen J, et al. Engineering Aspergillus niger for galactaric acid production: elimination of galactaric acid catabolism by using RNA sequencing and CRISPR/Cas9. Microb. Cell Fact 2016 Dic 12;15(1), 210. doi: 10.1186/s12934-016-0613-5

Kuivanen J., et al NADPH-dependent 5-keto-D-gluconate reductase is a part of the fungal pathway for D-glucuronate catabolism. FEBS Letters. 2017 Dic 30;592(1), 71–77. doi:10.1002/1873-3468.12946

Kuivanen J., et al. Clustered Genes Encoding 2-Keto-l-Gulonate Reductase and l-Idonate 5-Dehydrogenase in the Novel Fungal d-Glucuronic Acid Pathway. Front. Microbiol. 2017 Feb 14;8, 225. doi: 10.3389/fmicb.2017.00225

Kuivanen J., et al. Development of microtiter plate scale CRISPR/Cas9 transformation method for Aspergillus niger based on in vitro assembled ribonucleoprotein complexes. Fungal Biology and Biotechnology. 2019 Mar 15;6(1). doi:10.1186/s40694-019-0066-9

Kujoth G. C., et al. CRISPR/Cas9-Mediated Gene Disruption Reveals the Importance of Zinc Metabolism for Fitness of the Dimorphic Fungal Pathogen Blastomyces dermatitidi. mBio. 2018 Apr 3;9(2). doi:10.1128/mbio.00412-18

Kumari, M., et al. Antiproliferative and Antioxidative Bioactive Compounds in Extracts of Marine-Derived Endophytic Fungus Talaromyces purpureogenus. Frontiers in Microbiology. 2018 Aug 3; 9. doi:10.3389/fmicb.2018.01777

Kurniati E., et al. Potential Bioremediation of Mercury-Contaminated Substrate Using Filamentous Fungi Isolated from Forest Soil. Journal of Environmental Sciences 2014 Jun 1;26, 1223-1231. doi: 10.1016/S1001-0742(13)60592-6

Laich F., et al. Production of Penicillin by Fungi Growing on Food Products: Identification of a Complete Penicillin Gene Cluster in Penicillium griseofulvum and a Truncated Cluster in Penicillium verrucosum. Applied and Environmental Microbiology. 2002 Mar 1;68, 1211-1219. doi:10.1128/AEM.68.3.1211-1219.2002

Leynaud-Kieffer, et al. A new approach to Cas9-based genome editing in Aspergillus niger that is precise, efficient and selectable. PLOS ONE. 2019 Jun 17;14(1), e0210243. doi:10.1371/journal.pone.0210243

Li D., et al. Methods for genetic transformation of filamentous fungi. Microbial Cell Factories 2017; 16(1). doi: 10.1186/s12934-017-0785-7

Li J., et al. Introduction of Large Sequence Inserts by CRISPR-Cas9 To Create Pathogenicity Mutants in the Multinucleate Filamentous Pathogen Sclerotinia sclerotiorum. mBio 2018 Jun 26;9(3). doi: 10.1128/mBio.00567-18

Liang, Y., et al. Targeted Deletion of the USTA and UvSLT2 Genes Efficiently in Ustilaginoidea virens With the CRISPR-Cas9 System. Frontiers in Plant Science. 2018 May 24;9. doi:10.3389/fpls.2018.00699

Liu P., et al. Use of transcription activator-like effector for efficient gene modification and transcription in the filamentous fungus Trichoderma reesei. J Ind Microbiol Biotechnol. 2017;44: 1367–1373. doi:10.1007/s10295-017-1963-7

Liu Q., et al. Development of a genome-editing CRISPR/Cas9 system in thermophilic fungal Myceliophthora species and its application to hyper-cellulase production strain engineering. Biotechnol. Biofuels. 2017 Jan 3;10(1), 1. doi: 10.1186/s13068-016-0693-9

Liu R., et al. Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discovery. 2015a May 12, 1, 15007. doi: 10.1038/celldisc.2015.7

Lu S., et al. Development of an efficient vector system for gene knock-out and near in-cis gene complementation in the sugarcane smut fungus. Sci Rep. 2017;7: 1–8. doi:10.1038/s41598-017-03233-7

Majumder L., et al.  Citric Acid Production by Aspergillus niger Using Molasses and Pumpkin as Substrates. European Journal of Biological Sciences. 2010;2, 1-8.

Makarova K, et al. An updated evolutionary classification of CRISPR–Cas systems. Nature Reviews Microbiology. 2015; 13(11), 722-736.

Mantzouridou F.T., et al. Scale translation from shaken to diffused bubble aerated systems for lycopene production by Blakeslea trispora under stimulated conditions. Appl Microbiol Biotechnol. 2017 Nov 8;101:1845–1856. doi: 10.1007/s00253-016-7943-4

Marumo S, et al. Microbial production of abscisic acid by Botrytis cinereal. Agric Biol Chem. 1982 Sep 9; 46:1967–1968.doi:10.1080/00021369.1982.10865367

Matsu-ura T., et al. Efficient gene editing in Neurospora crassa with CRISPR technology. Fungal Biology and Biotechnology. 2015 Jul 15;2(1), 4. doi: 10.1186/s40694-015-0015-1

Matsuda, Y., et al. Novofumigatonin biosynthesis involves a non-heme iron-dependent endoperoxide isomerase for orthoester formation. Nature Communications 2018 Jul 3;9(1). doi:10.1038/s41467-018-04983-2

McLean K.J., et al. Single-Step Fermen-tative Production of the Cholesterol Lowering Drug Pravastatin via Reprogramming of Penicillium  chrysogenum. Proceedings  of  the  National  Academy  of  Sciences  of  the  United  States of America. 2015 Mar 3;112, 2847-2852. doi: 10.1073/pnas.1419028112

Méndez, A., et al. Red pigment production by Penicillium purpurogenum GH2 is influenced by pH and temperature. Journal of Zhejiang University SCIENCE B. 2011 Dec 6;12(12), 961–968. doi:10.1631/jzus.b1100039

Miao J., et al. Oxysterol-binding protein-related protein 2 is not essential for Phytophthora sojae based on CRISPR/Cas9 deletions. Environmental Microbiology Reports. 2018 Mar 9;10(3), 293–298. doi:10.1111/1758-2229.12638

Michelson P. Cheese: Exploring Taste and Tradition. 2010. Layton, UT: Gibbs Smith. ISBN-10: 9781423606512

Min K., et al. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 2016 Jun 15;1(3). doi:10.1128/msphere.00130-16

Mo X, et al. Production of linolenic acid by Mortierella isabellina grown on octadecanol. Curr Microbiol. 2002 Jun 22;44:141–144. doi:10.1007/s00284-001-0031-7

Montague T. G., et al. CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic acids research. 2014 May 26;42(1), W401–W407. doi:10.1093/nar/gku410

Nagy G., et al. CRISPR-Cas9-mediated disruption of the HMG-CoA reductase genes of Mucor circinelloides and subcellular localization of the encoded enzymes. Fungal Genetics and Biology. 2019 Apr 13; 129:30-39. doi:10.1016/j.fgb.2019.04.008

Nagy, G., et al. Development of a plasmid free CRISPR-Cas9 system for the genetic modification of Mucor circinelloides . Scientific Reports. 2017 Dic 1;7(1). doi:10.1038/s41598-017-17118-2

Naito, Y., et al. CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 2015 Apr 1;31(7), 1120–1123. doi:10.1093/bioinformatics/btu743

Nanou K, et al. Waste cooking oil: a new substrate for carotene production by Blakeslea trispora in submerged fermentation. Bioresour Technol. 2016 Dic 21;203:198–203. doi:10.1016/j.biortech.2015.12.053

Naranjo-Briceño L. et al. Potential Role of Extremophilic Hydrocarbonoclastic Fungi for Extra-Heavy Crude Oil Bioconversion and the Sustainable Development of the Petroleum Industry. Fungi In Extreme Environments: Ecological Role And Biotechnological Significance, 2019; 559-586. doi:10.1007/978-3-030-19030-9_28

Naranjo, L., Lamas-Maceiras, M., Ullán, R.V. et al. Characterization of the oat1 gene of Penicillium chrysogenum encoding an ω-aminotransferase: induction by L-lysine, L-ornithine and L-arginine and repression by ammonium. Mol Genet Genomics 274, 283–294 (2005). https://doi.org/10.1007/s00438-005-0019-2

Nelson, J.H. Production of Blue Cheese Flavor via Submerged Ermentation by Penicillium roqueforti. Journal of Agriculture and Food Chemistry. 1970 Jul 1;18, 567-569. doi: 10.1021/jf60170a024

Nielsen M. L., et al. Genes Linked to Production of Secondary Metabolites in Talaromyces atroroseus Revealed Using CRISPR-Cas9. PLoS One. 2017 Jan 5;12(1), e0169712. doi: 10.1371/journal.pone.0169712

Nishimatsu H, et al. Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell. 2014 Feb 27;156(5):935-49. doi:10.1016/j.cell.2014.02.001

Nødvig C. S., et al. A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS One. 2015 Jul 15;10(7), e0133085. doi: 10.1371/journal.pone.0133085

Nødvig C. S., et al. Efficient oligo nucleotide mediated CRISPR-Cas9 gene editing in Aspergilli. Fungal Genetics and Biology. 2018 Jan 8;115, 78–89. doi:10.1016/j.fgb.2018.01.004

Ogawa A., et al. Production of Kojic Acid from Aspergillus oryzae var. oryzae by Membrane-Surface Liquid Culture. Biotechnology Techniques. 1995 Feb;9, 153-156. doi: 10.1007/BF00224417

Oliveros J. C., et al. Breaking-Cas-interactive design of guide RNAs for CRISPR-Cas experiments for ENSEMBL genomes. Nucleic Acids Res. 2016 Jul 8;44(W1), 267–271. doi: 10.1093/nar/gkw407

Panagiotou G, et al. Intracelular metabolite profiling of Fusarium oxysporum converting glucose to ethanol. J Biotechnol. 2004 Sep 27;115(4): 425-34. doi: 10.1016/j.jbiotec.2004.09.011

Park J., et al. Cas-Designer: a web-based tool for choice of CRISPR-Cas9 target sites. Bioinformatics. 2015 Sep 10;31(24), 4014–4016. doi: 10.1093/bioinformatics/btv537

Peng D. Tarleton R. EuPaGDT: a web tool tailored to design CRISPR guide RNAs for eukaryotic pathogens. Microbial genomics. 2015; 1(4).

Pohl C., et al. CRISPR/Cas9 Based Genome Editing of Penicillium chrysogenum. ACS Synth. Biol. 2016 Apr 12;5(7), 754–764. doi: 10.1021/acssynbio.6b00082

Pushalkar S, et al. Ethanol fermentation by a cellulolytic fungus Aspergillus terreus.. World J Microbiol Biotechnol. 1998;14(2): 289-91. doi: 10.1023/A:1008863003763

Rodríguez-Rodríguez, D. R., et al. Genome editing: A perspective on the application of CRISPR/Cas9 to study human diseases (Review). International journal of molecular medicine. 2019 Feb 26;43(4), 1559–1574. doi:10.3892/ijmm.2019.4112

Román E., et al. Implementation of a CRISPR-Based System for Gene Regulation in Candida albicans . mSphere. 2019;4. doi:10.1128/msphere.00001-19

Roux I., et al. CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. 2020 Jun 11;9, 7, 1843–1854. doi: 10.1021/acssynbio.0c00197

Ryan O. W. y Cate J.H.D. Multiplex Engineering of Industrial Yeast Genomes Using CRISPRm. The Use of CRISPR/Cas9, ZFNs, and TALENs in Generating Site-Specific Genome Alterations. 2014; 473–489. doi:10.1016/b978-0-12-801185-0.00023-4

Sahasrabudhe N.A., et al. Characterization of the Purified Multifunctional Cellulase Component of P. funiculosum. FEMS Microbiology Letters, 1987 Feb;40, 315-319. doi: 10.1111/j.1574-6968.1987.tb02046.x

Sander J. D. y Joung J.K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 2014 Mar 2;32(4), 347–355. doi: 10.1038/nbt.2842

Schuster E., et al. On the Safety of Aspergillus niger—A Review. Applied Microbiology and Biotechnology. 2002 Apr 19;59,426-435. doi:10.1007/s00253-002-1032-6

Schuster M., et al. CRISPR-Cas9 genome editing approaches in filamentous fungi and oomycetes. Fungal Genetics And Biology, 2019; 130, 43-53. doi: 10.1016/j.fgb.2019.04.016

Schuster M., et al. Genome editing in Ustilago maydis using the CRISPR-Cas system. Fungal Genet. Biol. 2016 Sep 11;89, 3–9. doi: 10.1016/j.fgb.2015.09.001

Schuster M.,et al. Comparative analyses of secreted proteins in plant pathogenic smut fungi and related basidiomycetes. Fungal Genetics and Biology. 2018 Jan 6;112, 21–30. doi:10.1016/j.fgb.2016.12.003

Shah P., et al. Phytase production by Aspergillus niger NCIM 563 for a novel application to degrade organophosphorus pesticides. AMB Express. 2017 Mar 21;7(1). doi:10.1186/s13568-017-0370-9

Shapiro R. S., et al. A CRISPR–Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 2017;3(1), 73–82. doi:10.1038/s41564-017-0043-0

Sharmila K., et al. Production of Cyclosporin – A by Saprophytic Filamentous Fungus Fusarium oxysporum. International Journal of Pharmacy and Pharmaceutical Sciences. 2012 Jul 23;4, 149-153.

Shi TQ, et al. CRISPR/Cas9-based genome editing of the filamentous fungi: the state of the art. Applied microbiology and biotechnology, 2017, vol. 101, no 20, p. 7435-7443. doi: 10.1007/s00253-017-8497-9

Shi TQ, et al. Microbial production of plant hormones: opportunities and challenges. Bioengineered. 2017 Jul 26; 8:124–128. doi:10.1080/21655979.2016.1212138.

Shmakov S., et al. Diversity and evolution of class 2 CRISPR–Cas systems. Nature Reviews Microbiology. 2017; 15(3), 169.

Singh R., et al. Microbial enzymes: industrial progress in 21st century. 3 Biotech. 2016 Aug 19;6(2). doi:10.1007/s13205-016-0485-8

Slaymaker I.M., et al. Rationally engineered Cas9 nucleases with improved specificity. Science (80- ). 2016;351: 84–88. doi:10.1126/science.aad5227

Song, R., al. CRISPR/Cas9 genome editing technology in filamentous fungi: progress and perspective. Applied Microbiology And Biotechnology. 2019 Jul 22;103(17), 6919-6932. doi:10.1007/s00253-019-10007-w

Stemmer M., et al. CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool. PloS one. 2015 Apr 24;10(4), e0124633. doi:10.1371/journal.pone.0124633

Sugano S. S., et al. Genome editing in the mushroom-forming basidiomycete Coprinopsis cinerea, optimized by a high-throughput transformation system. Sci. Rep. 2017 Apr 28;7(1), 1260. doi: 10.1038/s41598-017-00883-5

Tang W.J., et al. Improvement of glucoamylase production using axial impellers with low power consumption and homogeneous mass transfer. Biochem Eng J. 2015 Jul 15;99:167–176. doi:10.1016/j.bej.2015.03.025

Van den Berg, et al. Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nature Biotechnology. 2008 Sep 28; 26(10), 1161–1168. doi:10.1038/nbt.1498

Van der Strat L., et al. Expression of the Aspergillus terreus Itaconic Acid Biosynthesis Cluster in Aspergillus niger. Microbial Cell Factories. 2014 Jan 17;13, 11. doi: 10.1186/1475-2859-13-11

Vanegas K.G., et al. Cpf1 enables fast and efficient genome editing in Aspergilli. Fungal Biol Biotechnol. 2019 May 1;6: 6. doi:10.1186/s40694-019-0069-6

Vyas V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere, 2018 Apr 25;3(2). doi:10.1128/msphere.00154-18

Wang P. Two Distinct Approaches for CRISPR-Cas9-Mediated Gene Editing in Cryptococcus neoformans and Related Species. mSphere. 2018b Apr 19;3(3). doi:10.1128/mspheredirect.00208-18

Wang Q. y Coleman J.J. Progress and Challenges: Development and Implementation of CRISPR/Cas9 Technology in Filamentous Fungi. Comput Struct Biotechnol J. 2019 ;17: 761–769. doi:10.1016/j.csbj.2019.06.007

Wang Q., et al. Efficient genome editing in Fusarium oxysporum based on CRISPR/Cas9 ribonucleoprotein complexes. Fungal Genetics and Biology. 2018a May 12;117, 21–29. doi:10.1016/j.fgb.2018.05.003

Wang S., et al. Molecular tools for gene manipulation in filamentous fungi. Applied Microbiology And Biotechnology, 2017; 101(22), 8063-8075. doi: 10.1007/s00253-017-8486-z

Weber J., et al. Functional Reconstitution of a Fungal Natural Product Gene Cluster by Advanced Genome Editing. ACS Synth. Biol. 2016 Sep 13;6(1), 62–68. doi: 10.1021/acssynbio.6b00203

Wenderoth M., et al. Establishment of CRISPR/Cas9 in Alternaria alternata. Fungal Genet. Biol. 2017;101, 55–60. doi: 10.1016/j.fgb.2017.03.001

Wensing L., et al. A CRISPR Interference Platform for Efficient Genetic Repression in Candida albicans. mSphere. 2019; 4(1), e00002-19.

Weyda I., et al. A comparison of Agrobacterium-mediated transformation and protoplast-mediated transformation with CRISPR-Cas9 and bipartite gene targeting substrates, as effective gene targeting tools for Aspergillus carbonarius. J. Microbiol. Methods. 2017 Feb 1;135, 26–34. doi: 10.1016/j.mimet.2017.01.015

Xiong X., et al. Accumulation of yellow Monascus pigments by extractive fermentation in nonionic surfactant micelle aqueous solution. Applied Microbiology and Biotechnology. 2014 Nov 10;99(3), 1173–1180. doi:10.1007/s00253-014-6227-0

Youssar L., et al. Intercellular communication is required for trap formation in the nematode-trapping fungus Duddingtonia flagrans. PLOS Genetics. 2019 Mar 27;15(3), e1008029. doi:10.1371/journal.pgen.1008029

Zetsche B, et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell. 2015 Oct 22;163: 759–771. doi:10.1016/j.cell.2015.09.038

Zhang C., et al. Highly efficient CRISPR mutagenesis by microhomology-mediated end joining in Aspergillus fumigatus. Fungal Genet. Biol. 2016 Dec 14;86, 47–57. doi: 10.1016/j.fgb.2015.12.007

Zhang Y., et al. Improved γ-linolenic acid production in Mucor circinelloides by homologous overexpressing of delta-12 and delta-6 desaturases. Microb Cell Factories. 2017 Jun 21;16:113. doi: 10.1186/s12934-017-0723-8

Zhang X.H., et al. Off-target effects in CRISPR/Cas9-mediated genome engineering. Molecular Therapy – Nucleic Acids. Nature Publishing Group; 2015. p. e264. doi:10.1038/mtna.2015.37

Zheng X., et al. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger. ACS Synthetic Biology. 2018 Apr 23; 19;8(7):1568-1574. doi:10.1021/acssynbio.7b00456

Zheng Y.-M., et al. Development of a versatile and conventional technique for gene disruption in filamentous fungi based on CRISPR-Cas9 technology. Scientific Reports. 2017 Aug 23;7(1). doi:10.1038/s41598-017-10052-3

 

 

 

Historial de publicación

Recibido: 29 septiembre 2019

Aprobado: 30 de octubre 2020

Publicado: 13 de noviembre de 2020

 

Palabras clave

CRISPR/Cas9, hongos filamentosos, edición genoma

⏰ ÚLTIMAS HORAS | 75% DTO en todos nuestros cursos
Ver cursos
close-image

Crea tu cuenta de Genotipia

Regístrate ahora y accede a la primera comunidad especializada en genética médica y genómica.

Los usuarios registrados de Genotipia disfrutan de:

  • Acceso a la comunidad de profesionales y a tu perfil
  • Acceso a los foros de la comunidad: noticias del día, bolsas de empleo, etc
  • Descuentos en nuestros cursos especializados
  • Acceso prioritario a jornadas y sorteos de Genotipia
  • Suscripción quincenal a Genética Médica News
  • Suscripción anual a nuestra revista científica: Genética Médica y Genómica
  • Este campo es un campo de validación y debe quedar sin cambios.